Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-361 precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-361 precursor URS00006EF3EB_9913

Automated summary: This pre miRNA sequence is 71 nucleotides long and is found in Bos taurus. Annotated by 4 databases (RefSeq, Rfam, ENA, miRBase). Described in 10 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-361, RF00744). Bos taurus (cattle) microRNA bta-mir-361 precursor sequence is a product of mir-361 precurso, mir-361 precursor, mir-361, bta-mir-361 precursor, MIR361, 361 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGAGCUUAUCAGAAUCUCCAGGGGUACUUAUAAUUUGAAAAAGUCCCCCAGGUGUGAUUCUGAUUUGCUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 7 other species

    1. Capra hircus (Goat) microRNA mir-361 (MIR361)
    2. Microcebus murinus miRNA
    3. Myotis brandtii microRNA mir-361
    4. Myotis davidii microRNA mir-361
    5. Myotis lucifugus microRNA 361
    6. Ochotona princeps miRNA
    7. Ovis aries miRNA
    8. Sus scrofa microRNA mir-361
    2D structure New