v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 874 (ENSSTOG00000020960.1) secondary structure diagram

Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 874 (ENSSTOG00000020960.1) URS00006EB0F5_43179

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAGCCCUGCGGCCCCACGCACCAGGGUAAGAGAGACUCACUUCCUGCCCUGGCCCGAGGGACCGACUGGCUGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus microRNA bta-mir-874 precursor
  2. Carlito syrichta miRNA (ENSTSYG00000020037.2)
  3. Cavia aperea (Brazilian guinea pig) microRNA 874 (ENSCAPG00000004371.1)
  4. Cavia porcellus microRNA 874 (ENSCPOG00000018893.2)
  5. Marmota marmota marmota (Alpine marmot) microRNA 874 (ENSMMMG00000006384.1)
  6. Marmota monax (woodchuck) non-coding RNA
  7. Mus musculus (house mouse) microRNA mmu-mir-874 precursor
  8. Mus spicilegus microRNA 874 (ENSMSIG00000020096.1)
  9. Mus spretus (algerian mouse) microRNA 874 (MGP_SPRETEiJ_G0007686.1)
  10. Nannospalax galili microRNA 874 (ENSNGAG00000006150.1)
  11. Sciurus vulgaris (Eurasian red squirrel) microRNA 874 (ENSSVLG00005009614.1)
  12. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000002697.1)
  13. Urocitellus parryii (Arctic ground squirrel) microRNA 874 (ENSUPAG00010016703.1)
 2D structure Publications