Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-448 precursor URS00006EA8E0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR448: MIR448 is a microRNA that has been studied in various contexts. It has been found that the binding sequence for the transcription factor REST is located within the 1 kb region of the MIR448 promoter. Silencing of the REST gene in normoxia leads to an increase in miR-448 expression and a decrease in SCN5A expression [PMC7714400]. Deletion of a specific promoter region from nt -687 to -151 significantly reduces transcriptional activity, indicating its importance for MIR448 regulation [PMC7714400]. MIR448 is located within an intron of the HTR2C gene, but it is regulated independently from HTR2C [PMC7714400]. In various studies, MIR448 has been found to be associated with malignancy and altered expression levels in different tissues [PMC9390975] [PMC6647430] [PMC5768721] [PMC5489807]. It has also been shown to regulate IDO1 and affect CD8+ T cells in human peripheral blood [PMC6686234]. Additionally, MIR448 displays complementarity with hepatitis C virus RNA and has been implicated in miRNA-mediated regulation of immune response and mammary lipogenesis through negative effects on PPARG [PMC4495342] [PMC9780829] [PMC7910866] 21,22[PMID: 4973084][PMID: 8139718].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGGGAGGUUGAACAUCCUGCAUAGUGCUGCCAGGAAAUCCCUAUUUCAUAUAAGAGGGGGCUGGCUGGUUGCAUAUGUAGGAUGUCCCAUCUCCCAGCCCACUUCGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications