Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000019859.1) URS00006E5426_9568

Automated summary: This pre miRNA sequence is 66 nucleotides long and is found in Mandrillus leucophaeus. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-378, RF00741). Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000019859.1) sequence is a product of ENSMLEG00000019859.1 gene. Found in the drill reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 144 other species

    1. Ailuropoda melanoleuca microRNA mir-378
    2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000006091.1)
    3. Bos taurus (cattle) microRNA bta-mir-378 precursor (bta-mir-378-1)
    4. Callithrix jacchus microRNA mir-378
    5. Camelus ferus microRNA mir-378
    6. Canis lupus familiaris microRNA mir-378
    7. Capra hircus (Goat) microRNA mir-378 (ENSCHIG00000001381.1)
    8. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000014439.1)
    9. Chinchilla lanigera miRNA (ENSCLAG00000021008.1)
    10. Chlorocebus sabaeus microRNA mir-378
    11. Colobus angolensis palliatus miRNA (ENSCANG00000016624.1)
    12. Cricetulus griseus microRNA 378a (ENSCGRG00000021384.1, ENSCGRG00001006212.1)
    13. Dipodomys ordii miRNA (ENSDORG00000022129.2)
    14. Echinops telfairi miRNA (ENSETEG00000021183.1)
    15. Equus caballus microRNA eca-mir-378 precursor
    16. Erinaceus europaeus microRNA mir-378
    17. Felis catus microRNA mir-378
    18. Fukomys damarensis miRNA (ENSFDAG00000002391.1)
    19. Heterocephalus glaber miRNA (ENSHGLG00000022209.1, ENSHGLG00100023997.1)
    20. Ictidomys tridecemlineatus miRNA (ENSSTOG00000016716.1)
    21. Macaca fascicularis (Crab-eating macaque) miRNA
    22. Macaca mulatta microRNA mml-mir-378a precursor
    23. Macaca nemestrina miRNA (ENSMNEG00000006665.1)
    24. Mesocricetus auratus microRNA 378a (ENSMAUG00000006588.1)
    25. Microcebus murinus (gray mouse lemur) microRNA 378a (ENSMICG00000035741.2)
    26. Microtus ochrogaster (vole) microRNA 378a (ENSMOCG00000007563.1)
    27. Mus caroli microRNA 378a (MGP_CAROLIEiJ_G0007602.1)
    28. Mus musculus microRNA mmu-mir-378a precursor
    29. Mus pahari (Shrew mouse) microRNA 378a (MGP_PahariEiJ_G0006934.1)
    30. Mus spretus (algerian mouse) microRNA 378a (MGP_SPRETEiJ_G0007974.1)
    31. Myotis brandtii microRNA mir-378
    32. Myotis lucifugus miRNA (ENSMLUG00000018041.1)
    33. Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 378a (ENSNGAG00000003705.1)
    34. Neotoma lepida microRNA mir-378
    35. Octodon degus miRNA (ENSODEG00000021812.1)
    36. Oryctolagus cuniculus microRNA mir-378
    37. Ovis aries microRNA mir-378
    38. Panthera pardus microRNA 378a (ENSPPRG00000013672.1)
    39. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000003138.1)
    40. Papio anubis microRNA mir-378
    41. Procavia capensis miRNA (ENSPCAG00000019108.1)
    42. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000009950.1)
    43. Rattus norvegicus (Norway rat) microRNA mir-378
    44. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000014371.1)
    45. Rhinopithecus roxellana miRNA (ENSRROG00000009119.1)
    46. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000001133.1)
    47. Tupaia chinensis microRNA mir-378
    48. Tursiops truncatus miRNA (ENSTTRG00000024143.1)