Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-378a precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-378a precursor URS00006E5426_10090

Automated summary: This pre miRNA sequence is 66 nucleotides long and is found in Mus musculus. Annotated by 7 databases (Ensembl, ENA, Ensembl/GENCODE, RefSeq, Rfam, MGI, miRBase). Described in 37 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-378, RF00741). Mus musculus (house mouse) microRNA mmu-mir-378a precursor sequence is a product of mir-378, mmu-mir-378a precursor, Mir378a, mir-378a precurso, 378, mir-378a, mir-378a precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Ailuropoda melanoleuca microRNA mir-378
    2. Aotus nancymaae miRNA
    3. Bos taurus microRNA bta-mir-378 precursor (bta-mir-378-1)
    4. Callithrix jacchus microRNA mir-378
    5. Camelus ferus microRNA mir-378
    6. Canis lupus familiaris microRNA mir-378
    7. Capra hircus (Goat) microRNA mir-378 (MIR378)
    8. Cercocebus atys (Sooty mangabey) miRNA
    9. Chinchilla lanigera (Long-tailed chinchilla) miRNA
    10. Chlorocebus sabaeus microRNA mir-378
    11. Colobus angolensis palliatus miRNA
    12. Cricetulus griseus (Chinese hamster) microRNA 378a
    13. Dipodomys ordii miRNA
    14. Echinops telfairi miRNA
    15. Equus caballus (horse) microRNA eca-mir-378 precursor
    16. Erinaceus europaeus microRNA mir-378
    17. Felis catus microRNA mir-378
    18. Fukomys damarensis (Damara mole rat) miRNA
    19. Heterocephalus glaber miRNA
    20. Ictidomys tridecemlineatus miRNA
    21. Macaca fascicularis (Crab-eating macaque) miRNA
    22. Macaca mulatta microRNA mml-mir-378a precursor
    23. Macaca nemestrina miRNA
    24. Mandrillus leucophaeus (Drill) miRNA
    25. Mesocricetus auratus (Golden Hamster) microRNA 378a
    26. Microcebus murinus miRNA
    27. Microtus ochrogaster microRNA 378a
    28. Mus caroli microRNA 378a
    29. Mus pahari microRNA 378a
    30. Mus spretus microRNA 378a
    31. Myotis brandtii microRNA mir-378
    32. Myotis lucifugus miRNA
    33. Nannospalax galili microRNA 378a
    34. Neotoma lepida microRNA mir-378
    35. Octodon degus (Degu) miRNA
    36. Oryctolagus cuniculus microRNA mir-378
    37. Ovis aries microRNA mir-378
    38. Panthera pardus microRNA 378a
    39. Panthera tigris altaica (Tiger) miRNA
    40. Papio anubis (Olive baboon) miRNA
    41. Procavia capensis (cape rock hyrax) miRNA
    42. Propithecus coquereli (Coquerel's sifaka) miRNA
    43. Rattus norvegicus microRNA mir-378
    44. Rhinopithecus bieti miRNA
    45. Rhinopithecus roxellana miRNA
    46. Saimiri boliviensis boliviensis miRNA
    47. Tupaia chinensis microRNA mir-378
    48. Tursiops truncatus (bottlenosed dolphin) miRNA
    2D structure New