Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca nemestrina (Pig-tailed macaque) miRNA secondary structure diagram

Macaca nemestrina (Pig-tailed macaque) miRNA URS00006E154A_9545

Automated summary: This pre miRNA sequence is 128 nucleotides long and is found in Macaca nemestrina. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-490, RF00792). Found in the pig-tailed macaque reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAGGCCUUGCUGGUUUGGAAAGUUCAUUGUUCGACACCAUGGAUCUCCAGGUGGGUCAAGUUUAGAGAUGCACCAACCUGGAGGACUCCAUGCUGUUGAGCUGUUCACAAGCAGCGGACACUUCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Colobus angolensis palliatus miRNA
    3. Homo sapiens microRNA hsa-mir-490 precursor
    4. Macaca fascicularis miRNA
    5. Macaca mulatta microRNA mml-mir-490 precursor
    6. Mandrillus leucophaeus (Drill) miRNA
    7. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    8. Pan paniscus (bonobo) miRNA
    9. Pan troglodytes (chimpanzee) ptr-mir-490
    10. Papio anubis (Olive baboon) miRNA
    11. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    12. Pongo abelii miRNA
    13. Rhinopithecus bieti miRNA
    14. Rhinopithecus roxellana miRNA
    15. Theropithecus gelada microRNA 490
    2D structure New