Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1227 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1227 precursor URS00006DE17B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1227: Hsa-mir-1227 is a differentially regulated miRNA that has been identified in various studies as a potential biomarker for prognosis, diagnosis, and treatment of liver diseases, articular cartilage conditions, and cancer recurrence [PMC7582243] [PMC3495209] [PMC5759858]. It has been found to be involved in the regulation of MECP2 expression and activity, epigenetic regulation of gene expression, degradation of the extracellular matrix, peroxisomal protein import [PMC7582243]. Hsa-mir-1227 has also been associated with metastatic behaviors in breast cancer and gastric cancer [PMC3495209]. Additionally, it has been shown to enhance migration of cancer-associated fibroblasts and is abundant in large oncosomes [PMC3495209]. Hsa-mir-1227 has been validated as a target for hsa-miR-10b and hsa-miR-146b-3p in different studies [PMC5759858]. Furthermore, it is one of the miRNAs that have shown significant correlation with recurrence in osteosarcoma [PMC5759858]. The predicted targets regulated by hsa-mir-1227 include a high number of transcription proteins as well as secretory, membrane, surface or receptor proteins [PMC3495209]. References: [PMC7582243] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7582243/ [PMC3495209] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3495209/ [PM5759858] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM5759858/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGGGCCAGGCGGUGGUGGGCACUGCUGGGGUGGGCACAGCAGCCAUGCAGAGCGGGCAUUUGACCCCGUGCCACCCUUUUCCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications