Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-558 precursor URS00006DB970_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-558: The candidate miRNA hsa-mir-558 has been identified in various studies [PMC6948356]. It is significantly downregulated in multiple disease conditions [PMC4268797]. Hsa-mir-558 targets the COX-II and mPGES-1 enzymes, along with other miRNAs such as hsa-miR-101a, hsa-miR-708, hsa-miR-16, hsa-miR-137, and hsa-miR-340 [PMC8452524]. It is predicted to be regulated by MALAT1 and GSDMD [PMC9200665]. Hsa-mir-558 displays length variations with 18 repeats in a significant proportion of MSI cell lines and MSI CRCs [PMC3279428]. Changes in the expression patterns of hsa-mir-558 have been observed after exposure to low and high doses of X-ray in human fibroblasts [PMC3424689].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUGUGUGUGUGUGUGUGGUUAUUUUGGUAUAGUAGCUCUAGACUCUAUUAUAGUUUCCUGAGCUGCUGUACCAAAAUACCACAAACGGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications