Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-938 precursor URS00006DA7A7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR938: MIR938 is a microRNA that has been identified in breast cancer, colon cancer, ovarian cancer, and liver cancer, where it post-transcriptionally regulates PHLPP2 [PMC8078721]. In a pilot study, MIR938 was found to be differentially methylated [PMC4446486]. A variant in the MIR938 gene has been associated with decreased risk of gastric cancer [PMC10003057]. Variants in the MIR938 gene have also been correlated with neurological toxicity during ALL treatment [PMC10003057]. In addition to gastric cancer, MIR938 has been associated with other cancers and has the potential to modulate the therapeutic response of standard treatment for ALL [PMC10003057]. The genomic region of MIR938 was amplified from human DNA samples for analysis [PMC6687864]. The rs12416605 variant in MIR938 affects its expression and regulation of target genes such as CXCL12 and CCR5 [PMC6687864]. The C allele of rs12416605 is associated with increased expression of MIR938 and repression of CXCL12, potentially promoting GC metastasis [PMC6687864]. The T allele of rs12416605 is inversely associated with the risk for diffuse subtype gastric cancer but not intestinal subtype gastric cancer [PMC6687864]. SNP-like variants in the pre-MIR938 gene have also been associated with changes in MIR938 biogenesis and stability [PMC9503809].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGGUGUACCAUGUGCCCUUAAAGGUGAACCCAGUGCACCUUCAUGAACCGUGGUACACCUUUAAGAACUUGGUAUGCCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications