Ovis aries (sheep) miRNA (ENSOARG00000022072.1, ENSOARG00020017321.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miRNA (ENSOARG00000022072.1, ENSOARG00020017321.2) URS00006CB7E5_9940

100 nucleotides
1 database (Ensembl)
Found in 10 other species
19 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGUUGGGCGGGGUGCGGGGCUAGGGCUAACAGCAGGCUCACUGACGGUUUCCCGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Bison bison bison (American bison) microRNA 744 (ENSBBBG00000013846.1)
Bos grunniens (domestic yak) microRNA 744 (ENSBGRG00000018047.1)
Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000013339.1, ENSBIXG00005016490.1)
Bos mutus (wild yak) microRNA 744 (ENSBMUG00000012581.1)
Bos taurus (cattle) microRNA bta-mir-744 precursor
Capra hircus (Goat) miRNA (ENSCHIG00010010870.1)
Cervus elaphus hippelaphus ncRNA
Cervus hanglu yarkandensis (Yarkand deer) microRNA 744 (ENSCHYG00000011920.1)
Moschus moschiferus microRNA 744 (ENSMMSG00000024008.1)

2D structure

Publications