Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-744 precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-744 precursor URS00006CB7E5_9913

Automated summary: This pre miRNA sequence is 100 nucleotides long and is found in Bos taurus. Annotated by 5 databases (miRBase, RefSeq, Rfam, ENA, Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-744, RF00936). Bos taurus (cattle) microRNA bta-mir-744 precursor sequence is a product of mir-744, ENSBTAG00000030109.2, mir-744 precurso, 744, mir-744 precursor, MIR744, bta-mir-744 precursor genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGUUGGGCGGGGUGCGGGGCUAGGGCUAACAGCAGGCUCACUGACGGUUUCCCGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure Publications New