Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-511 precursor URS00006BADF6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR511: MIR511 is a type of MirRNA that is classified as one of the MirRNA targets in a study [PMC4877674]. It is largely expressed in the alimentary system and plays a role in response to stimulus [PMC8369952]. The interactions between Adh6-ps1, Mir455, and MIR511 are important to understand because they may contribute to the understanding of hepatocellular carcinoma (HCC) [PMC8369952]. Mir455 and MIR511 were found to be downregulated in diethylnitrosamine chemically induced HCC in a rat model [PMC8369952]. The activation of the notch signaling pathway, which plays a role in liver development, lipid metabolism, and lipogenesis, was also reported in the same HCC rat model [PMC8369952]. Adh6-ps1 is moderately expressed in HCC, and its association with Mir455 and MIR511 suggests that it may have a secondary role in tumorigenesis and disease phenotypes [PMC8369952]. Mir361 is implicated specifically in endometrial cancers, while Mir455 is associated with HCC as well as gastric cancer (GC) and colorectal cancer (CRC) [PMC8369952]. The limited number of wheat EST sequences available may have contributed to the inability to predict targets for MIR511 among other new miRNAs studied [PMC2394755]. DEGs were found to target motifs of microRNAs including MIR511 [PMC8901935]. miR30a upregulation attenuates Bcl2 and Bax protein after irradiation while MIR511 can enhance Bax to block the growth of radiotherapy-resistant A549 cells. Knockdown of miR95 speeds up irradiation-induced apoptosis with an increase in caspase 3/9 levels and reduction in Bcl2 levels. Other mechanisms are also involved in miRNA-mediated apoptosis [PMC6525830].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAUAGACACCCAUCGUGUCUUUUGCUCUGCAGUCAGUAAAUAUUUUUUUGUGAAUGUGUAGCAAAAGACAGAAUGGUGGUCCAUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications