Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 17 (SNORD17) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 17 (SNORD17) URS00006BA413_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD17: SNORD17 is a small nucleolar RNA (snoRNA) that has been identified as an oncogene in various human tumors, including hepatocellular carcinoma (HCC) and cervical cancer. Its level in plasma exosomes has been found to be a diagnostic and prognostic marker for cervical cancer [PMC9454744]. SNORD17 has been shown to undergo stringent editing, with 18 editing sites identified in 10 miRNAs and 2 snoRNAs [PMC5844249]. Co-localization experiments have demonstrated that SNORD17 is found in close proximity to TRF2, a marker protein of telomeres [PMC4395285]. SNORD17 is involved in a reciprocal regulation with p53, forming a positive feedback loop that contributes to tumorigenesis and development [PMC9454744]. Additionally, SNORD17 can be regulated by the non-coding splicing factor SF3B1, which is frequently mutated in chronic lymphocytic leukemia (CLL) [PMC9873975]. Furthermore, downregulated genes include SNORD17 among others [PMC9025840]. In summary, SNORD17 is an oncogenic snoRNA that plays a role in various human tumors. Its level in plasma exosomes can serve as a diagnostic and prognostic marker for cervical cancer. It undergoes stringent editing and shows co-localization with TRF2. It also participates in reciprocal regulation with p53 and can be regulated by SF3B1. Furthermore, it is downregulated along with other genes.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGAUGAUUCAGUUUAUCCAUUCGCUGAGUGCGCUGCACUGACCUUCUUCCAAGCCUCAGUUCCUGUUCUAGGAACUUGAGGCUAUGUAGCCUGAAAAUGCCCUGCAGUCUGCAGUGUUCUACUGUGAACUGCUUGUGUGUUGGCAGGCUACCGGUAAGAAUGGUUGGUGUCAGCAGGGACGGGGCCCUCUGAGACCCAUCUCACAAAGAUGAGUGGUGAAAAUCUGAUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications