Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 44 (SNORD44) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 44 (SNORD44) URS00006B8984_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD44: SNORD44 is a small nucleolar RNA (snoRNA) that is part of a group of small noncoding RNAs, including small nuclear RNA and small nucleolar RNA [PMC4793896]. In a study, LNATM PCR primer sets were used to analyze miR expression, and the relative quantification of specific miRs to SNORD44 was carried out [PMC8728617]. Another study investigated the binding of SNORD44 sdRNAs or the long form to FBL [PMC4159348]. In the context of aging and osteoarthritis (OA), it was found that SNORD26 was increased in OA, while SNORD44 and SNORD78 were reduced in aging [PMC7326970]. Additionally, SNORD44 (RNU44) has been identified as significantly associated with distant disease-free survival in breast cancer, suggesting its potential as a biomarker for metastatic progression [PMC9818347]. Furthermore, concentrations of non-coding small nuclear RNAs like SNORD44 have been used for sample-to-sample normalization in certain studies [PMC4813272]. Lastly, miRNA expression data were normalized to the expression levels of SNORD25, SNORD44, and SNORD68 in a study that compared different groups [PMC4431491].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGGAUGAUGAUAAGCAAAUGCUGACUGAACAUGAAGGUCUUAAUUAGCUCUAACUGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications