Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-326 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-326 precursor URS00006A8564_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR326: MIR326 is a microRNA that has been associated with progression-free survival (PFS) in certain cases, such as miR155, miR210, and miR130a [PMC7073212]. It has been found that miR29a targets HIV-1 US vRNA and leads to translational repression, while miR133b, miR138-5, MIR326, miR149-5p, and miR92a-3p have been shown to reduce HIV-1 replication [PMC9237370]. Additionally, the expression of MIR326 negatively correlates with HIV-1 infection [PMC9237370].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAUCUGUCUGUUGGGCUGGAGGCAGGGCCUUUGUGAAGGCGGGUGGUGCUCAGAUCGCCUCUGGGCCCUUCCUCCAGCCCCGAGGCGGAUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

2D structure Publications