Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-326 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-326 precursor URS00006A8564_9606

  • 95 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 22 species

Automated summary: This pre miRNA sequence is 95 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (Rfam, GeneCards, Ensembl/GENCODE, miRBase, Ensembl, ENA, HGNC, RefSeq, MalaCards). Described in 48 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-326, RF00719). Homo sapiens (human) microRNA hsa-mir-326 precursor sequence is a product of mir-326 precursor, 326, mir-326, mir-326 precurso, hsa-mir-326 precursor, MIR326 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUCAUCUGUCUGUUGGGCUGGAGGCAGGGCCUUUGUGAAGGCGGGUGGUGCUCAGAUCGCCUCUGGGCCCUUCCUCCAGCCCCGAGGCGGAUUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Aotus nancymaae miRNA
    2. Callithrix jacchus microRNA mir-326
    3. Cercocebus atys (Sooty mangabey) miRNA
    4. Chlorocebus sabaeus (African green monkey) miRNA
    5. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 326
    6. Macaca fascicularis miRNA
    7. Macaca nemestrina miRNA
    8. Mandrillus leucophaeus (Drill) miRNA
    9. Microcebus murinus miRNA
    10. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    11. Pan paniscus (bonobo) miRNA
    12. Pan troglodytes (chimpanzee) ptr-mir-326
    13. Papio anubis (Olive baboon) miRNA
    14. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    15. Pongo abelii microRNA 326
    16. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-326 precursor
    17. Prolemur simus miRNA
    18. Propithecus coquereli (Coquerel's sifaka) miRNA
    19. Rhinopithecus bieti miRNA
    20. Rhinopithecus roxellana miRNA
    21. Saimiri boliviensis boliviensis miRNA
    22. Theropithecus gelada microRNA 326
    2D structure New