Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000014338.1) secondary structure diagram

Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000014338.1) URS00006A8564_61621

Automated summary: This pre miRNA sequence is 95 nucleotides long and is found in Rhinopithecus bieti. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-326, RF00719). Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000014338.1) sequence is a product of ENSRBIG00000014338.1 gene. Found in the black snub-nosed monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUCAUCUGUCUGUUGGGCUGGAGGCAGGGCCUUUGUGAAGGCGGGUGGUGCUCAGAUCGCCUCUGGGCCCUUCCUCCAGCCCCGAGGCGGAUUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    2D structure New