Homo sapiens (human) microRNA hsa-mir-663a precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-663a precursor URS00006A470C_9606

93 nucleotides
7 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
Found in 0 other species
563 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR663A: MIR663A is a microRNA that has been found to suppress colorectal cancer (CC) metastasis [PMC6365692]. In contrast, TTC22V1 has been shown to promote CC metastasis [PMC6365692]. The significance of MIR663A downregulation by MALAT1 was evaluated by studying the expression changes of a set of MIR663A target genes, including P5319, PIK3CD12, P2111, CXCR413, TGFB120, and JUND21, in HCT116 cells [PMC6113222].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCUUCCGGCGUCCCAGGCGGGGCGCCGCGGGACCGCCCUCGUGUCUGUGGCGGUGGGAUCCCGCGGCCGUGUUUUCCUGGUGGCCCGGCCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications