Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-152 precursor URS00006A0932_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR152: MIR152 is a microRNA that has been found to play a role in various cellular processes [PMC9994484]. In a study, it was observed that in cells exposed to lipopolysaccharide (LPS) in the presence of MK1903, the expression of miR‐128, miR‐425, and miR‐130 was significantly increased compared to both the LPS and vehicle groups [PMC9994484]. On the other hand, the expression of miR‐19, MIR152, miR‐301, and miR‐29 was rescued to control levels [PMC9994484]. Additionally, it has been discovered that lncRNA plasmacytoma variant translocation 1 (PVT1) triggers liver epithelial-mesenchymal transition (EMT) by competitively binding to MIR152 [PMC8990740]. These findings suggest that MIR152 may have a regulatory role in cellular responses to LPS exposure and liver EMT [PMC9994484][PMC8990740]. Further research is needed to fully understand the mechanisms by which MIR152 functions and its potential implications in various biological processes [PMC9994484][PMC8990740].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCCCCCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAGUCAGUGCAUGACAGAACUUGGGCCCGGAAGGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications