Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1208 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1208 precursor URS00006A01F2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1208: Hsa-mir-1208 is a microRNA that has been studied in relation to various diseases, including prostate cancer and TNF-α cell group [PMC3140991] [PMC6111343]. In prostate cancer, hsa-mir-1208 was found to be expressed in all tested samples and showed an interesting pattern of expression and interaction with the genotype of rs378854 [PMC3140991]. In the TNF-α cell group, hsa-mir-1208 was down-regulated compared to the control group [PMC6111343]. Hsa-mir-1208 has also been found to be predicted to interact with hsa_circ_0003829 and circNOL10 [PMC7545778] [PMC7780627]. Additionally, hsa-mir-1208 has been identified as one of the down-regulated miRNAs associated with worse overall survival in a study on high-risk signatures [PMC7139587]. However, it is important to note that hsa-mir-1208 was observed as an outlier with an extreme increase in high hazard ratios and was excluded from downstream analysis in this study [PMC7139587]. Further studies are needed to fully understand the role of hsa-mir-1208 in diseases and its potential as a therapeutic target.

MIR1208: MIR1208 is a microRNA gene located at chromosome 8q24.21 [PMC6467893]. It is associated with focal amplifications unique to TCGA, which contain MYC and MIR1208 [PMC6467893]. One of the miR-SNPs in the 3' end of precursor MIR1208, rs2648841, represents a separate signal from the IMSGC GWAS signals [PMC10061723]. Another MIR1208 SNP, rs1861842, has been associated with multiple sclerosis in African Americans [PMC10061723]. Six candidate miR-SNPs associated with multiple sclerosis were identified within the precursor, loop, and seed regions of MIR548AC, MIR1208, MIR3135b, and MIR6891 [PMC10061723]. In pancreatic diseases such as pancreatitis and pancreatic ductal adenocarcinoma (PDAC), downregulation of miR1208 has been observed in patients compared to healthy pancreatic tissue [PMC9599289]. In PDAC patients specifically, alterations in miR1208 were observed at different stages of the disease [PMC9599289]. Furthermore, alterations in miR1208 were also observed between chronic pancreatitis and PDAC patients [PMC9599289]. In a study using the UTSW dataset from cBioPortal for PDAC detection, a panel of 18 microRNAs including MIR1208 exhibited alterations across a majority of PDAC patients sampled [PMC9599289]. Additionally, recurrent copy number changes were observed at chromosome 8q24.21 where MIR1208 is located [PMC2966422]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCGGCAGAAUCACUGUUCAGACAGGCGGAGACGGGUCUUUCUCGCCCUCUGAUGAGUCACCACUGUGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla gorilla microRNA 1208 (ENSGGOG00000031292.2)
  2. Pan troglodytes microRNA mir-1208
2D structure Publications