v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rattus norvegicus (Norway rat) microRNA rno-mir-409a precursor secondary structure diagram

Rattus norvegicus (Norway rat) microRNA rno-mir-409a precursor URS000069AD99_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUACUCGGAGAGAGGUUACCCGAGCAACUUUGCAUCUGGAGGACGAAUGUUGCUCGGUGAACCCCUUUUCGGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 0 other species

  1. Cricetulus griseus microRNA mir-154
  2. Mesocricetus auratus microRNA mir-154
  3. Mus musculus microRNA mir-154
  4. Neotoma lepida microRNA mir-154
 2D structure Publications