v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-675 precursor URS0000691556_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR675: MIR675 is a long non-coding RNA (lncRNA) that has been studied in tumors. In a study, it was found that knockdown of MIR675 in tumors resulted in a significantly lower percentage of Ki67 positive cells compared to control tumors [PMC4741653]. However, the role of lncRNA H19 or MIR675 has not been investigated in patients with heterotopic ossification (HO) or mouse models of HO formation [PMC9753082].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCAGGGUCUGGUGCGGAGAGGGCCCACAGUGGACUUGGUGACGCUGUAUGCCCUCACCGCUCAGCCCCUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Gorilla gorilla gorilla microRNA 675 (ENSGGOG00000029089.2)
  2. Gorilla gorilla (western gorilla) microRNA mir-675
  3. Nomascus leucogenys microRNA 675 (ENSNLEG00000024002.2)
  4. Pan paniscus microRNA 675 (ENSPPAG00000000373.1)
  5. Pan troglodytes microRNA 675 (ENSPTRG00000048390.1)
  6. Pongo abelii (Sumatran orangutan) microRNA mir-675
  7. Pongo pygmaeus microRNA ppy-mir-675a precursor
 Publications