Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-302a precursor URS0000689179_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR302A: MIR302A is a microRNA that is part of the miR-302 family, which includes MIR302B, MIR302C, and MIR302D [PMC5906557]. It is highly expressed in embryonic stem cells but declines rapidly after differentiation [PMC6722449]. MIR302A has been shown to be involved in various biological processes and diseases. For example, it has been found to be associated with the inhibition of EC migration and proliferation in end-stage renal disease [PMC8685359]. In addition, dysregulation of MIR302A has been implicated in hepatocarcinogenesis and contributes to microvesicle-mediated transfer of miRNAs and dysfunction of the NF-κB signaling pathway [PMC4761210]. Furthermore, MIR302A has been shown to regulate the expression of p65 by binding with ZFP91 directly [PMC8365611]. It has also been found to be related to tumor size and metastasis in colorectal cancer patients [PMC7602903]. Moreover, overexpression of miR-302s (including MIR302A) induces apoptosis in cancer cell lines [PMC4400607]. Overall, MIR302A plays a crucial role in various biological processes and diseases through its regulation of gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAGAAGUAAGUGCUUCCAUGUUUUGGUGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications