Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes (chimpanzee) ptr-mir-433 (ENSPTRG00000028112.2) secondary structure diagram

Pan troglodytes (chimpanzee) ptr-mir-433 (ENSPTRG00000028112.2) URS0000688CFC_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGGGGAGAAGUACGGUGAGCCUGUCAUUAUUCAGAGAGGCUAGAUCCUCUGUGUUGAGAAGGAUCAUGAUGGGCUCCUCGGUGUUCUCCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Callithrix jacchus mir-433 microRNA precursor family
  2. Canis lupus familiaris mir-433 microRNA precursor family
  3. Carlito syrichta miRNA (ENSTSYG00000035866.1)
  4. Cavia porcellus (Domestic guinea pig) mir-433 microRNA precursor family
  5. Cebus imitator microRNA 433 (ENSCCAG00000009715.1)
  6. Cercocebus atys miRNA (ENSCATG00000006527.1)
  7. Chlorocebus sabaeus mir-433 microRNA precursor family
  8. Cricetulus griseus mir-433 microRNA precursor family
  9. Felis catus microRNA 433 (ENSFCAG00000016653.3)
  10. Fukomys damarensis mir-433 microRNA precursor family
  11. Gorilla gorilla gorilla microRNA 433 (ENSGGOG00000029959.2)
  12. Gorilla gorilla (western gorilla) mir-433 microRNA precursor family
  13. Heterocephalus glaber (naked mole-rat) mir-433 microRNA precursor family
  14. Homo sapiens microRNA hsa-mir-433 precursor
  15. Loxodonta africana (African savanna elephant) microRNA 433 (ENSLAFG00000023675.1)
  16. Lynx canadensis (Canada lynx) microRNA 433 (ENSLCNG00005001183.1)
  17. Mandrillus leucophaeus miRNA (ENSMLEG00000020805.1)
  18. Mus musculus mir-433 microRNA precursor family
  19. Mustela putorius furo mir-433 microRNA precursor family
  20. Neotoma lepida mir-433 microRNA precursor family
  21. Nomascus leucogenys microRNA 433 (ENSNLEG00000025194.2)
  22. Pan paniscus microRNA 433 (ENSPPAG00000005945.1)
  23. Panthera leo microRNA 433 (ENSPLOG00000008690.1)
  24. Panthera pardus (leopard) microRNA 433 (ENSPPRG00000022586.1)
  25. Panthera tigris altaica microRNA 433 (ENSPTIG00000003612.1)
  26. Papio anubis mir-433 microRNA precursor family
  27. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 433 (ENSPEMG00000004073.2)
  28. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000004051.1)
  29. Pongo abelii mir-433 microRNA precursor family
  30. Pongo pygmaeus microRNA ppy-mir-433 precursor
  31. Rattus norvegicus microRNA rno-mir-433 precursor
  32. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000015543.1)
  33. Rhinopithecus roxellana miRNA (ENSRROG00000010387.1)
  34. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000001530.1)
2D structure Publications