Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-433 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-433 precursor URS0000688CFC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR433: MIR433 is a microRNA that has been studied in various contexts. One study reported that down-regulation of MIR433 is associated with tumor suppression [PMC8235499]. In the brain with multiple system atrophy (MSA), MIR433 with reduced expression in the striatum is involved in the regulation of HDAC6 expression [PMC9025474]. MIR433 has been grouped by tertiles for statistical analysis [PMC3593171]. In a limited cohort of samples, differential signatures have shown upregulation of miR101, miR25, miR26b, miR335, and MIR433 [PMC7959144]. The binding between CREB1 and the MIR433 promoter has been studied using LV5-NC- and LV5-CREB1-infected cells [PMC6326693]. Several microRNAs, including MIR128, miR125, and MIR433, have been shown to regulate NMD factors [PMC6173407]. The expression of MIR433 has been observed in various diseases such as bladder tumor tissues and neurodegenerative diseases like Parkinson's disease and Huntington's disease [PMC4348104] [PMC4794499] [PMC9781427]. In esophageal cancer and glioma, MIR433 plays an important role [PMC9753082]. It has also been implicated in regulating OPN/SPP1 expression in bone tissues during tibial fracture healing [PMC9753082]. The expression of OPN/SPP1 is regulated by microRNAs including MIR433. Additionally, it has been shown that estrogen-related ERRĪ³ receptor may regulate transcription of the MIR433 gene from its locus. Furthermore, urinary excretion profile analysis showed an increase in fibrosis activators such as miR-21 or decrease in fibrosis suppressors like miR-29 or miR-200 in patients with renal fibrosis compared to healthy subjects [PMC6612965].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGGGGAGAAGUACGGUGAGCCUGUCAUUAUUCAGAGAGGCUAGAUCCUCUGUGUUGAGAAGGAUCAUGAUGGGCUCCUCGGUGUUCUCCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Callithrix jacchus mir-433 microRNA precursor family
  2. Canis lupus familiaris mir-433 microRNA precursor family
  3. Carlito syrichta miRNA (ENSTSYG00000035866.1)
  4. Cavia porcellus (Domestic guinea pig) mir-433 microRNA precursor family
  5. Cebus imitator microRNA 433 (ENSCCAG00000009715.1)
  6. Cercocebus atys miRNA (ENSCATG00000006527.1)
  7. Chlorocebus sabaeus mir-433 microRNA precursor family
  8. Cricetulus griseus mir-433 microRNA precursor family
  9. Felis catus microRNA 433 (ENSFCAG00000016653.3)
  10. Fukomys damarensis mir-433 microRNA precursor family
  11. Gorilla gorilla gorilla microRNA 433 (ENSGGOG00000029959.2)
  12. Gorilla gorilla (western gorilla) mir-433 microRNA precursor family
  13. Heterocephalus glaber (naked mole-rat) mir-433 microRNA precursor family
  14. Loxodonta africana (African savanna elephant) microRNA 433 (ENSLAFG00000023675.1)
  15. Lynx canadensis (Canada lynx) microRNA 433 (ENSLCNG00005001183.1)
  16. Mandrillus leucophaeus miRNA (ENSMLEG00000020805.1)
  17. Mus musculus mir-433 microRNA precursor family
  18. Mustela putorius furo mir-433 microRNA precursor family
  19. Neotoma lepida mir-433 microRNA precursor family
  20. Nomascus leucogenys microRNA 433 (ENSNLEG00000025194.2)
  21. Pan paniscus microRNA 433 (ENSPPAG00000005945.1)
  22. Panthera leo microRNA 433 (ENSPLOG00000008690.1)
  23. Panthera pardus (leopard) microRNA 433 (ENSPPRG00000022586.1)
  24. Panthera tigris altaica microRNA 433 (ENSPTIG00000003612.1)
  25. Pan troglodytes ptr-mir-433 (ENSPTRG00000028112.2)
  26. Papio anubis mir-433 microRNA precursor family
  27. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 433 (ENSPEMG00000004073.2)
  28. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000004051.1)
  29. Pongo abelii mir-433 microRNA precursor family
  30. Pongo pygmaeus microRNA ppy-mir-433 precursor
  31. Rattus norvegicus microRNA rno-mir-433 precursor
  32. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000015543.1)
  33. Rhinopithecus roxellana miRNA (ENSRROG00000010387.1)
  34. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000001530.1)
2D structure Publications