Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-433 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-433 precursor URS0000688CFC_9606

  • 93 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 53 species

Automated summary: This pre miRNA sequence is 93 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (Ensembl/GENCODE, miRBase, RefSeq, Ensembl, MalaCards, ENA, HGNC, GeneCards, Rfam). Described in 46 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-433, RF00748). Homo sapiens (human) microRNA hsa-mir-433 precursor sequence is a product of MIR433, 433, hsa-mir-433 precursor, mir-433 precursor, mir-433, ENSG00000207569.2, mir-433 precurso genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCGGGGAGAAGUACGGUGAGCCUGUCAUUAUUCAGAGAGGCUAGAUCCUCUGUGUUGAGAAGGAUCAUGAUGGGCUCCUCGGUGUUCUCCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 52 other species

    1. Callithrix jacchus microRNA mir-433
    2. Canis lupus familiaris microRNA mir-433
    3. Carlito syrichta miRNA (ENSTSYG00000035866.1)
    4. Cavia porcellus microRNA mir-433
    5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000006527.1)
    6. Chlorocebus sabaeus microRNA mir-433
    7. Cricetulus griseus microRNA mir-433
    8. Felis catus (domestic cat) miRNA (ENSFCAG00000016653.3)
    9. Fukomys damarensis microRNA mir-433
    10. Gorilla gorilla gorilla microRNA 433 (ENSGGOG00000029959.2)
    11. Heterocephalus glaber microRNA mir-433
    12. Loxodonta africana (African savanna elephant) microRNA 433 (ENSLAFG00000023675.1)
    13. Lynx canadensis microRNA 433 (ENSLCNG00005001183.1)
    14. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000020805.1)
    15. Mus musculus microRNA mir-433
    16. Mustela putorius furo microRNA mir-433
    17. Neotoma lepida microRNA mir-433
    18. Nomascus leucogenys miRNA (ENSNLEG00000025194.2)
    19. Pan paniscus miRNA (ENSPPAG00000005945.1)
    20. Panthera leo microRNA 433 (ENSPLOG00000008690.1)
    21. Panthera pardus microRNA 433 (ENSPPRG00000022586.1)
    22. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000003612.1)
    23. Pan troglodytes ptr-mir-433 (ENSPTRG00000028112.2)
    24. Papio anubis miRNA (ENSPANG00000000707.2)
    25. Peromyscus maniculatus bairdii microRNA 433 (ENSPEMG00000004073.2)
    26. Piliocolobus tephrosceles miRNA (ENSPTEG00000004051.1)
    27. Pongo abelii microRNA mir-433
    28. Pongo pygmaeus microRNA ppy-mir-433 precursor
    29. Rattus norvegicus microRNA rno-mir-433 precursor
    30. Rhinopithecus bieti miRNA (ENSRBIG00000015543.1)
    31. Rhinopithecus roxellana miRNA (ENSRROG00000010387.1)
    32. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000001530.1)
    2D structure New