Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-522 precursor URS0000680AAF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-522: Hsa-mir-522 is a microRNA that belongs to the hsa-mir-519a cluster [PMC4424562]. It was assayed along with hsa-mir-512 and showed a similar change in gene expression, indicating that this cluster may be regulated as a single unit [PMC4424562]. Seven miRNAs, including hsa-mir-522, were found to have significantly overrepresented targets in MCF7 cells [PMC4401570]. In addition, hsa-mir-522 was predicted to differentially target the FXN gene depending on the allele [PMC3559822]. Variations in the FRDA-3'-UTR created novel target sites for hsa-mir-522 and other miRNAs [PMC3559822]. Hsa-mir-522 has been found to be mentioned in 16 open access papers listed in the miRBase dataset, with many of them focusing on its role in tumor cell proliferation [PMC7366700].

MIR522: MIR522 is a microRNA that has been found to be upregulated in women with recurrent pregnancy loss (RPL) compared to normal controls [PMC5572592]. It is one of the 18 microRNAs (MIR27A, MIR31, MIR93, MIR96, MIR122, MIR130B, MIR133A1, MIR203A, MIR210, MIR330, MIR339, MIR425, MIR429, MIR522, MIR590, MIR664A, MIR1208, and MIR3620) [PMC9599289]. The TCGA miRNA-seq dataset of LIHC (HCC) was processed to get cumulative miRNA expression of all 46 C19MC miRNA genes, including MIR522 [PMC7378193]. Most importantly, it has been found that ubiquitin-specific protease 7 (USP7) stabilizes heterogeneous ribonucleoprotein A1 (hnRNPA1) through deubiquitination, and hnRNPA1 mediates the filling of MIR522 into exosomes [PMC9519351]. MIR522 is also part of a subset of miRNAs associated with stem cell biology and tumorigenesis [PMC8508841].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGGUUCCCUUUAGAGUGUUACGCUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications