Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-422a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-422a precursor URS000067E604_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR422A: MIR422A is a microRNA that has been identified and validated in various studies [PMC5878888]. It has been found to be associated with processes such as apoptosis/survival, migration/chemotaxis, adhesion, transendothelial migration, differentiation into osteoclasts, histamine biosynthesis, glucocorticoid sensitivity, regulation of oxidative stress, and protein folding [PMC5878888]. MIR422A has been shown to be significantly associated with MVC% and MVC [PMC5803610]. It is one of the nine statistically significant miRNAs found in a conditional logistic regression analysis [PMC4436811]. MIR422A has been reported to inhibit the translation of mRNA encoding CYP7A protein [PMC8147992]. It has also been implicated in cholestatic liver diseases [PMC8147992]. In addition, MIR422A is predicted to target various genes involved in ion channel regulation and muscle growth pathways [PMC7763385] [PMC8396502]. It has also been found to be negatively correlated with hTERT protein expression levels [PMC4431439] and positively correlated with lncR-D63785 and MEF2D expressions in DOX-resistant GC cells [PMC8381522] [PMC8396502]. Furthermore, MIR422A levels have been shown to be reduced in aUC compared to iUC patients [PMC6879552], while exhibiting diurnal oscillations in the mouse retina along with other microRNAs such as miR96 and miR124a[ PMC3092095].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAGAAGCACUGGACUUAGGGUCAGAAGGCCUGAGUCUCUCUGCUGCAGAUGGGCUCUCUGUCCCUGAGCCAAGCUUUGUCCUCCCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications