Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-633 precursor URS0000678203_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-633: Hsa-mir-633 is a microRNA that has been identified as a potential regulator of GC resistance in pediatric acute lymphoblastic leukemia (ALL) [PMC6069764]. It is one of six miRNAs, including hsa-miR-221-3p, hsa-miR-550a-3p, hsa-miR-638, hsa-miR-124-5p, and hsa-miR-15b-3p, that have no retrieved targets after filtering [PMC6069764]. Hsa-mir-633 has been found to functionally correlate with circ_0008896 and up-regulating its level using hsa-mir-633 mimics [PMC8973975]. Bioinformatics analysis using TargetScan has identified CDC20B 3ʹUTR as a potential binding site for hsa-mir-633 [PMC8973975]. Hsa_circ_0008896, which is highly expressed in atherosclerosis models, increases the expression of CDC20B by binding to hsa-mir-633 [PMC8973975]. The role of hsa_circ_0008896 in the proliferation, migration and invasion of VSMCs (vascular smooth muscle cells) has been identified and suggests that both hsa_mir_633 and CDC20B could be potential therapeutic targets [PMC8973975]. Luciferase reporter plasmids have confirmed the direct binding between hsa_mir_633 and the 3ʹUTR of CDC20B [PMC8973975]. Additionally, transwell assay results have shown that inhibiting hsa_mir_633 can reverse the decreased migration and invasion abilities caused by circ_0008896 knockdown in VSMCs [PMC8973975]. The binding between circ_0008896 and hsa_mir_633 has been confirmed through luciferase reporter plasmids [PMC8973975]. The expression level of CDC20B is tightly controlled by hsa_mir_633 [PMC8973975]. The downstream effects of circ_0008896 and hsa_mir_633 on CDC20B have been confirmed through functional assays and down-regulation of CDC20B using si-CDC20B [PMC8973975]. In atherosclerosis models, the level of hsa_mir_633 is decreased [PMC8973975].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCUCUCUUAGCCUCUGUUUCUUUAUUGCGGUAGAUACUAUUAACCUAAAAUGAGAAGGCUAAUAGUAUCUACCACAAUAAAAUUGUUGUGAGGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications