Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-299a precursor URS0000676278_10090

Automated summary: This pre miRNA sequence is 63 nucleotides long and is found in Mus musculus. Annotated by 7 databases (Ensembl, RefSeq, ENA, Ensembl/GENCODE, Rfam, MGI, miRBase). Described in 16 papers. Matches 1 Rfam family (mir-299, RF00756). Mus musculus (house mouse) microRNA mmu-mir-299a precursor sequence is a product of mir-299a, mir-299a precursor, 299, mmu-mir-299a precursor, mir-299, mir-299a precurso, Mir299a genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAGAAAUGGUUUACCGUCCCACAUACAUUUUGAGUAUGUAUGUGGGACGGUAAACCGCUUCUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Camelus ferus microRNA mir-299
    2. Canis lupus familiaris microRNA cfa-mir-299 precursor
    3. Mus caroli microRNA 299a
    4. Mus spretus microRNA 299a
    5. Nannospalax galili miRNA
    6. Pteropus alecto microRNA mir-299
    7. Pteropus vampyrus microRNA 299
    8. Rattus norvegicus microRNA rno-mir-299a precursor
    9. Saimiri boliviensis boliviensis miRNA
    10. Tupaia belangeri microRNA 299
    11. Tupaia chinensis microRNA mir-299
    12. Vicugna pacos (alpaca) miRNA