Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-544a precursor URS0000674174_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR544A: MIR544A is an oncogene that has been identified in various studies [PMC5983208]. However, its role in peri-implantitis and periodontitis has not been extensively studied [PMC8684662]. Contrary to the results obtained from next-generation sequencing (NGS), quantitative real-time polymerase chain reaction (qRT-PCR) showed a decrease in the expression of MIR544A in PMSII [PMC8684662]. MIR544A has been found to regulate inflammation in spinal cord injury by inhibiting the expression of NEUROD4 [PMC8684662]. These findings provide a valuable reference for further investigation of MIR544A in peri-implantitis and periodontitis [PMC8684662]. To validate the miRNA profile analysis, four miRNAs, including MIR544A, were randomly selected for verification using qRT-PCR [PMC8684662]. Other miRNAs that were commonly found across different profiles included MIR4719, miR6886 (up-regulated), and miR302F, miR579, temire, miR1200, miR548H5, and miR4284 (down-regulated) [PMC8553949]. Among these microRNAs, MIR548ai showed the most significant upregulation relative to MIR544A in smooth muscle cells stimulated with PDGF [PMC8553949]. The interaction between CDH1 and MIR544A was confirmed using a luciferase assay [PMC4051809]. A study focused on two microRNAs - miR-124 and MIR544A - but only measured them in a small population. Further research is needed to determine their diagnostic value on a larger scale population [PMC9436774]. In summary, while there is limited research on the role of MIR544A in peri-implantitis and periodontitis, it has been identified as an oncogene and has been shown to regulate inflammation in spinal cord injury. Further investigation is required to fully understand its significance in these conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUUUCAUCACCUAGGGAUCUUGUUAAAAAGCAGAUUCUGAUUCAGGGACCAAGAUUCUGCAUUUUUAGCAAGUUCUCAAGUGAUGCUAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Aotus nancymaae miRNA (ENSANAG00000008828.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) microRNA cja-mir-544 precursor
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 544a (ENSCCAG00000031197.1)
  4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000009889.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 544a (ENSCSAG00000022422.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000007280.1)
  7. Fukomys damarensis microRNA mir-544
  8. Gorilla gorilla gorilla microRNA 544a (ENSGGOG00000029800.2)
  9. Heterocephalus glaber microRNA 544a (ENSHGLG00000022551.2, ENSHGLG00100024147.2)
  10. Macaca fascicularis microRNA 544a (ENSMFAG00000013085.2)
  11. Macaca mulatta microRNA mml-mir-544 precursor
  12. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000015119.1)
  13. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010390.1)
  14. Nomascus leucogenys microRNA 544a (ENSNLEG00000024300.2)
  15. Pan paniscus microRNA 544a (ENSPPAG00000007368.1)
  16. Pan troglodytes ptr-mir-544 (ENSPTRG00000028102.2)
  17. Papio anubis (olive baboon) miRNA (ENSPANG00000027465.3)
  18. Piliocolobus tephrosceles miRNA (ENSPTEG00000002632.1)
  19. Pongo abelii miRNA (ENSPPYG00000021038.2)
  20. Pongo pygmaeus microRNA ppy-mir-544 precursor
  21. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000023361.1)
  22. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000019171.1)
  23. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000027616.1)
  24. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019370.1)
  25. Theropithecus gelada (gelada) microRNA 544a (ENSTGEG00000007597.1)
  26. Tupaia belangeri microRNA 544a (ENSTBEG00000018032.1)
  27. Tupaia chinensis microRNA mir-544
Publications