Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 3D (SNORD3D) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 3D (SNORD3D) URS0000660F0A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD3D: SNORD3D is a dysregulated U3 small nucleolar ribonucleoprotein gene that is associated with age-related immune dysfunction, G0/G1 to S phase transition, oxidative-/ER-stress, and the pathogenesis of Alzheimer's disease [PMC9359077]. In a study investigating the ceRNA network, SNORD3D was found to be one of the 12 lncRNAs involved [PMC7859920]. Treatment with SL resulted in the up-regulation of SNORD3D and other genes involved in RNA processing and translation [PMC4039240]. SNORD3D was also identified as one of the four snoRNAs among 39 genes associated with early-response, stress-response/immune genes, haemoglobin, and breast cancer progression [PMC4818440]. In terms of immunotherapy response in patients with esophageal adenocarcinoma (EAC), SNORD3D was found to be a risk factor for unfavorable responses [PMC9751999]. Additionally, SNORD3D was identified as one of the top dysregulated snoRNAs in a study investigating Upf1 silencing [PMC7415794]. However, there were no significant differences in the expression of SNORD3D between hepatocellular carcinoma (HCC) tissues and pair-matched normal liver tissues [PMC7415794]. References: - PMC9359077 - PMC7859920 - PMC4039240 - PMC4818440 - PMC9751999 - PMC7415794

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGCUAUACUUUCAGGGAUCAUUUCUAUAGUGUGUUACUAGAGAAGUUUCUUUGAACGUGUAGAGCACCGAAAACCCCGAGGAAGAGAGGUAGCGUUUUCUCCUGAGCGUGAAGCCGGCUUUCUGGCGUUGCUUGGCUGCAACUGCCGUCAGCCAUUGAUGAUCGUUCUUCUCUCCGUAUUGGGGAGUGAGAGGGAGAGAACGCGGUCUGAGUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications