Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-875 precursor URS000065D4D7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR875: MIR875 is a microRNA that is transcribed from a tooth-specific transcription start site (TSS) in the chromosome 15qD1 region [PMC7080778]. The TSS of MIR875 can be accurately predicted using CAGE analysis [PMC7080778]. The promoter region of MIR875 can be bound by the transcription co-activator PRRX1/2, which induces the expression of MIR875 [PMC7080778]. The function of PRRX1/2 in the MIR875 promoter was confirmed using luciferase reporter vectors [PMC7080778]. Additionally, PRRX1 and PRRX2 were found to bind to the promoter region of MIR875 and induce its expression [PMC7080778]. The JASPAR database was used to identify potential transcription factors that can bind to the promoter region of MIR875 [PMC7080778]. Mutant reporter plasmids were constructed to study the function of specific sequences in the MIR875 promoter [PMC7080778]. qRT-PCR and RNA-sequence analysis confirmed the expression of MIR875 in tooth samples [PMC7080778]. The findings suggest that PRRXs regulate MIR875 expression and may play a role in dental mesenchymal cell differentiation during tooth development [PMC7080778]. Furthermore, it has been suggested that miRNAs, including MIR875, participate in different processes related to wood formation and tooth germ development [PMC9081728] [PMC8633455] . Overall, these findings indicate that MIR875 may be a critical regulator of dental mesenchymal migration and condensation during tooth morphogenesis, potentially through its interaction with PDGF signaling pathway via epithelial-mesenchymal interaction during tooth morphogenesis[ PMC9081728] . Additionally, PRRX1 has been implicated in tumor metastasis and can bind to the promoter region of MIR875 to stimulate the maturation of miR-875-5p and promote tumor cell migration [PMC8291965].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAGUGGUACUAUACCUCAGUUUUAUCAGGUGUUCUUAAAAUCACCUGGAAACACUGAGGUUGUGUCUCACUGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications