Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-503 precursor URS00006588D4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR503: MIR503 is a microRNA that has been studied in the context of various diseases, including esophageal squamous cell carcinoma (ESCC) [PMC6694630]. In a study analyzing the gene expression profile of pHPL-ASC passage-specific genes, it was found that MIR503 was consistently downregulated in all passages (P1 to P5) [PMC6694630]. Furthermore, when comparing tumor samples from ESCC patients to adjacent non-tumorous tissues, a significant decrease in MIR503 expression was observed in 83% of the patients [PMC5487524]. This suggests that MIR503 may play a role in the development or progression of ESCC [PMC5487524]. Additionally, it has been noted that MIR503 is present in the 3' fragment of mir322 and may influence its fate [PMC4057207]. These findings highlight the potential importance of MIR503 as a biomarker or therapeutic target for ESCC [PMC6694630][PMC5487524][PMC4057207]. Further research is needed to elucidate its precise role and mechanisms of action in this context [PMC6694630][PMC5487524][PMC4057207].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCCUAGCAGCGGGAACAGUUCUGCAGUGAGCGAUCGGUGCUCUGGGGUAUUGUUUCCGCUGCCAGGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications