Pan paniscus (bonobo) microRNA 129-2 (ENSPPAG00000005570.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) microRNA 129-2 (ENSPPAG00000005570.1) URS00006515A6_9597

90 nucleotides
1 database (Ensembl)
Found in 8 other species
41 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Erinaceus europaeus microRNA 129-2 (ENSEEUG00000016098.1)
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 129-2 (ENSGGOG00000034639.2)
Homo sapiens (human) microRNA hsa-mir-129 precursor (hsa-mir-129-2)
Nomascus leucogenys microRNA 129-2 (ENSNLEG00000024846.2)
Pan troglodytes ptr-mir-129-2 (ENSPTRG00000027789.3)
Pongo abelii mir-129 microRNA precursor family
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-129 precursor (ppy-mir-129-2)
Propithecus coquereli miRNA (ENSPCOG00000012633.1)

2D structure

Publications