Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 13 (SNORD13) URS000064F355_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD13: SNORD13 is a small nuclear RNA gene that has been found to have increased expression levels [PMC5647002]. However, its expression may not be directly involved in the current model of pain transmission [PMC5647002]. There is a correlation between SNORD13 and the status of mutant huntingtin carriers and Huntington's disease, but not with the CAG number [PMC10094222]. Through BLAST searches and manual inspection, many novel candidate homologs of SNORD13 have been identified outside the vertebrate lineage, including Urochordata, Cephalochordata, Echinodermata, Arthropoda, Mollusca, Brachiopoda, Cnidaria and even Porifera [PMC9226516]. SNORD13 has paralogs encoded on different chromosomal locations that have been found to be methylated [PMC5579392].

mRNA interactions 8 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCCUUUUGUAGUUCAUGAGCGUGAUGAUUGGGUGUUCAUACGCUUGUGUGAGAUGUGCCACCCUUGAACCUUGUUACGACGUGGGCACAUUACCCGUCUGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications