Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-578 precursor URS000064EB09_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-578: Hsa-mir-578 is a microRNA that has been implicated in various biological processes and diseases [PMC8173208]. It has been found to be differentially expressed in gestational diabetes mellitus (GDM), suggesting its potential role in this condition [PMC8173208]. Hsa-mir-578 has also been identified as a potential binding partner for circ_0006677, indicating its involvement in circRNA-miRNA interactions [PMC8155686]. In addition, hsa-mir-578 has been shown to be upregulated in combined analyses of GSE46823 and GSE83292 datasets, along with other miRNAs [PMC9812810]. It has been found to modulate the expression of SHOX2, CTNNB1, and EGFR mRNAs through a coexpression network [PMC9260928]. Hsa-mir-578 has also been implicated in the regulation of XPNPEP1, UCHL1, DBNL, GPC6, and RAD51 expression or activity through sponging specific miRNAs [PMC9627163]. Furthermore, hsa-mir-578 has been shown to regulate the expression of HIF1A, VEGFA, ANGPT2, and FAK genes in different cell types [PMC4381608]. It is also known to interact with other miRNAs such as hsa-miR-140-3P and hsa-miR-145-5p [PMC7595675][PMC8324362].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUAAAUCUAUAGACAAAAUACAAUCCCGGACAACAAGAAGCUCCUAUAGCUCCUGUAGCUUCUUGUGCUCUAGGAUUGUAUUUUGUUUAUAUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications