v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1226 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1226 precursor URS000064B9B1_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGAGGGCAUGCAGGCCUGGAUGGGGCAGCUGGGAUGGUCCAAAAGGGUGGCCUCACCAGCCCUGUGUUCCCUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Cercocebus atys (Sooty mangabey) microRNA 1226 (ENSCATG00000008098.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 1226 (ENSCSAG00000021989.1)
  3. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000004259.1)
  4. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 1226 (ENSGGOG00000033314.2)
  5. Macaca fascicularis microRNA 1226 (ENSMFAG00000007004.2)
  6. Macaca mulatta microRNA mml-mir-1226 precursor
  7. Macaca nemestrina microRNA 1226 (ENSMNEG00000027083.1)
  8. Pan paniscus microRNA 1226 (ENSPPAG00000000883.1)
  9. Pan troglodytes microRNA ptr-mir-1226 precursor
  10. Papio anubis (olive baboon) microRNA 1226 (ENSPANG00000001506.3)
  11. Piliocolobus tephrosceles microRNA 1226 (ENSPTEG00000005581.1)
  12. Pongo abelii microRNA 1226 (ENSPPYG00000022142.2)
  13. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1226 precursor
  14. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 1226 (ENSRBIG00000008087.1)
  15. Rhinopithecus roxellana microRNA 1226 (ENSRROG00000014722.1)
  16. Theropithecus gelada microRNA 1226 (ENSTGEG00000010227.1)
 2D structure Publications