Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-891a precursor URS00006497FB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-891a: Hsa-mir-891a is a microRNA that has been found to interact with 11 genes [PMC7298280]. In a study on patients with nasopharyngeal carcinomas, it was observed that hsa-mir-891a, along with other sEV-resident miRNAs such as hsa-miR-24-3p, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were upregulated in the serum [PMC8431296]. However, no gene was found to interact with hsa-mir-338 [PMC7298280]. These findings suggest that hsa-mir-891a may play a role in the development or progression of nasopharyngeal carcinomas and could potentially serve as a biomarker for this disease. Further research is needed to fully understand the functional significance of this microRNA and its potential implications in cancer biology.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUAAUCCUUGCAACGAACCUGAGCCACUGAUUCAGUAAAAUACUCAGUGGCACAUGUUUGUUGUGAGGGUCAAAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications