Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000012026.1) secondary structure diagram

Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000012026.1) URS0000638811_61621

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUUAUGCACCACGGAUGUUUGAGCAUGUGCUAUGGUGUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000017556.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 105-2 (ENSCSAG00000026627.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000017088.1)
  4. Gorilla gorilla gorilla microRNA 105-2 (ENSGGOG00000038473.1)
  5. Homo sapiens microRNA hsa-mir-105 precursor (hsa-mir-105-2)
  6. Macaca fascicularis (Crab-eating macaque) microRNA 105-2 (ENSMFAG00000061436.1)
  7. Macaca mulatta microRNA mml-mir-105 precursor (mml-mir-105-2)
  8. Macaca nemestrina miRNA (ENSMNEG00000021064.1)
  9. Mandrillus leucophaeus miRNA (ENSMLEG00000014365.1)
  10. Marmota marmota marmota (Alpine marmot) microRNA 105-2 (ENSMMMG00000011887.1)
  11. Marmota monax non-coding RNA
  12. Nomascus leucogenys microRNA 105-2 (ENSNLEG00000027589.1)
  13. Oryctolagus cuniculus microRNA 105-2 (ENSOCUG00000023608.1)
  14. Otolemur garnettii miRNA (ENSOGAG00000033430.1)
  15. Pan paniscus microRNA 105-2 (ENSPPAG00000005530.1)
  16. Pan troglodytes (chimpanzee) microRNA ptr-mir-105 precursor
  17. Papio anubis miRNA (ENSPANG00000038815.1)
  18. Piliocolobus tephrosceles microRNA 105-2 (ENSPTEG00000021508.1)
  19. Pongo abelii miRNA (ENSPPYG00000037861.1)
  20. Pongo pygmaeus microRNA ppy-mir-105 precursor (ppy-mir-105-2)
  21. Prolemur simus microRNA 105-2 (ENSPSMG00000026017.1)
  22. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 105-2 (ENSRROG00000000131.1)
  23. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000011877.1, ENSSDAG00000011881.1, ENSSDAG00000015250.1)
  24. Ictidomys tridecemlineatus mir-105 microRNA precursor family
  25. Theropithecus gelada (gelada) microRNA 105-2 (ENSTGEG00000008254.1)
  26. Urocitellus parryii (Arctic ground squirrel) microRNA 105-2 (ENSUPAG00010020239.1)
2D structure