Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-105 precursor (hsa-mir-105-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-105 precursor (hsa-mir-105-2) URS0000638811_9606

Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (GeneCards, ENA, HGNC, Ensembl, RefSeq, Rfam, miRBase). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-105, RF00670). Homo sapiens (human) microRNA hsa-mir-105 precursor (hsa-mir-105-2) sequence is a product of hsa-mir-105-2 precursor, 105 microRNA precursor famil, MIR105-2, mir-105-2 precurso, mir-105-2, 105 microRNA precursor family, mir-105-2 precursor, 105-2, 2, mir-105 microRNA precursor family, ENSG00000207818.1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUUAUGCACCACGGAUGUUUGAGCAUGUGCUAUGGUGUCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Cercocebus atys (Sooty mangabey) miRNA MIR105-2 (ENSCATG00000017556.1)
    2. Chlorocebus sabaeus miRNA MIR105-2 (ENSCSAG00000026627.1)
    3. Colobus angolensis palliatus miRNA (ENSCANG00000017088.1)
    4. Gorilla gorilla gorilla microRNA 105-2 (ENSGGOG00000038473.1)
    5. Macaca fascicularis microRNA 105-2 (ENSMFAG00000061436.1)
    6. Macaca mulatta microRNA mml-mir-105 precursor (mml-mir-105-2)
    7. Macaca nemestrina microRNA 105-2 (ENSMNEG00000021064.1)
    8. Mandrillus leucophaeus microRNA 105-2 (ENSMLEG00000014365.1)
    9. Marmota marmota marmota (Alpine marmot) microRNA 105-2 (ENSMMMG00000011887.1)
    10. Marmota monax (woodchuck) non-coding RNA
    11. Nomascus leucogenys miRNA (ENSNLEG00000027589.1)
    12. Oryctolagus cuniculus microRNA 105-2 (ENSOCUG00000023608.1)
    13. Otolemur garnettii microRNA 105-2 (ENSOGAG00000033430.1)
    14. Pan paniscus (bonobo) miRNA (ENSPPAG00000005530.1)
    15. Pan troglodytes (chimpanzee) microRNA ptr-mir-105 precursor
    16. Papio anubis miRNA (ENSPANG00000038815.1)
    17. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 105-2 (ENSPTEG00000021508.1)
    18. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000037861.1)
    19. Pongo pygmaeus microRNA ppy-mir-105 precursor (ppy-mir-105-2)
    20. Prolemur simus microRNA 105-2 (ENSPSMG00000026017.1)
    21. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 105-2 (ENSRBIG00000012026.1)
    22. Rhinopithecus roxellana microRNA 105-2 (ENSRROG00000000131.1)
    23. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000011877.1, ENSSDAG00000011881.1, ENSSDAG00000015250.1)
    24. Ictidomys tridecemlineatus mir-105 microRNA precursor family
    25. Theropithecus gelada microRNA 105-2 (ENSTGEG00000008254.1)
    26. Urocitellus parryii (Arctic ground squirrel) microRNA 105-2 (ENSUPAG00010020239.1)
    2D structure Publications New