Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1912 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1912 precursor URS0000638502_9600

80 nucleotides
1 database (miRBase)
Found in 5 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUCUAGGAUGUGCUCAUUGCAUGGGCUGUGUAUAGUAUUAUUCAAUACCCAGAGCAUGCAGUGUGAACAUAAUAGAGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Homo sapiens (human) microRNA hsa-mir-1912 precursor
Pan paniscus microRNA 1912 (ENSPPAG00000007328.1)
Pan troglodytes (chimpanzee) microRNA 1912 (ENSPTRG00000036617.2)
Pongo abelii microRNA 1912 (ENSPPYG00000026869.2)