Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-636 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-636 precursor URS000062E57E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-636: Hsa-mir-636 is a key miRNA that has been implicated in the pathogenesis of neuropsychiatric and other neurodegenerative disorders [PMC5962550]. In a study, the expression disruption of hsa-mir-636 was found to be connected to these disorders [PMC5962550]. Additionally, during the second trimester, hsa-mir-636 was significantly increased in the ICP (intrahepatic cholestasis of pregnancy) group [PMC9990296]. This increase in hsa-mir-636 expression suggests its potential role in the pathogenesis of ICP [PMC9990296]. Furthermore, hsa-miR-767-3p was also significantly increased during the second trimester in the ICP group [PMC9990296]. These findings highlight the potential involvement of hsa-mir-636 and hsa-miR-767-3p in ICP and suggest their relevance as biomarkers for this condition [PMC9990296].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCGGCCUGGGCGGGAGCGCGCGGGCGGGGCCGGCCCCGCUGCCUGGAAUUAACCCCGCUGUGCUUGCUCGUCCCGCCCGCAGCCCUAGGCGGCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications