Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-497 precursor URS000062BB4A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR497: MIR497 is a microRNA that has been shown to regulate neuronal death following ischemia [PMC4998122]. However, a recent study has identified a new association between MIR497 and seizure-induced damage, making it the first to do so [PMC4998122]. Additionally, studies have demonstrated that MIR497 can sensitize lung cancer cells to cisplatin resistance treatment in an AKT2-dependent manner [PMC8787930]. Furthermore, it has been suggested that LINC00152 acts as a sponge and negatively regulates MIR497 [PMC7011539]. MicroRNAs are small non-coding RNA molecules that play crucial roles in gene regulation. MIR497 specifically has been found to be involved in neuronal death following ischemia [PMC4998122]. This indicates its potential importance in understanding and potentially treating ischemic brain injury. However, the present study is the first to establish an association between MIR497 and seizure-induced damage, expanding our understanding of its role in neurological disorders [PMC4998122]. In addition to its role in neuronal death and seizure-induced damage, MIR497 has also been implicated in lung cancer. It has been shown that MIR497 can sensitize lung cancer cells to cisplatin resistance treatment through an AKT2-dependent mechanism. This finding suggests the potential of targeting MIR497 as a therapeutic strategy for overcoming cisplatin resistance in lung cancer patients [PMC8787930]. Furthermore, LINC00152 has been identified as a negative regulator of MIR497. It acts as a sponge for this microRNA, potentially reducing its availability for gene regulation. This finding highlights the complexity of microRNA regulation and suggests LINC00152 as a potential therapeutic target for modulating the activity of MIR497 [PMC7011539].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACCCCGGUCCUGCUCCCGCCCCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCACGUCCAAACCACACUGUGGUGUUAGAGCGAGGGUGGGGGAGGCACCGCCGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications