Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-223 precursor URS00006291D1_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-223: Rno-mir-223 is a specific mature miRNA that was assessed using the TaqMan MicroRNA assay [PMC3864878]. It is also predicted to target the gene SLC4A1 [PMC5748115]. In a study on rat PASMC, RhoB was confirmed as a direct target of rno-mir-223 [PMC4848472]. Rno-mir-223 was included in the miRCURY locked nucleic acid (LNA)™ microRNA detection probes purchased from Exiqon [PMC4905434]. In the development of HFpEF, rno-mir-223 was strongly associated with the disease [PMC7667132]. In an early IR-injury regulatory network, rno-mir-223 was identified as one of the top miRNA-hubs [PMC4424502]. Additionally, at 7d post-injury, rno-mir-223 had a high degree of connectivity in the network [PMC4424502]. Rno-mir-223 is one of three miRNAs that have validated dendritic targets [PMC5978931]. Rno-mir-223 is an important miRNA that has been studied in various contexts and has been associated with different target genes and disease conditions. It plays a role in gene regulation and has been identified as a key player in various biological processes. Further research on rno-mir-223 and its targets will contribute to our understanding of its functional significance.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCCUUCUGCAGUGUUACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCUUAUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications