Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-432 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-432 precursor URS00006284D8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR432: MIR432 is a microRNA that has been implicated in various biological processes and diseases. In a study, it was found that MIR432, along with other miRNAs, was a target for miR324-5p and was located near the promoter regions of NR6A1, POU3F2, CUTL1, PAX8, and AHR transcription factors [PMC4619381]. In the context of ovarian cancer drug resistance, it was hypothesized that MIR432 may also play a role in drug resistance in lung adenocarcinoma (LAD) [PMC4991437]. The study found a negative correlation between the levels of MIR432 and the levels of E2F3 and AXL in LAD [PMC4991437]. Additionally, decreased levels of MIR432 were observed along with other miRNAs (MIR700 and MIR692-1), which could contribute to relieved post-transcriptional gene repression [PMC4077804]. However, direct binding of p53 to MIR432 could not be confirmed in a neuroblastoma cell line with wild-type p53 [PMC4356961]. In another study investigating genetic associations at the 14q32 region, SNP rs2400963 and its flanking genes (including MIR432) were identified at this locus [PMC6202974]. Overall, these findings suggest that MIR432 may have functional roles in drug resistance and gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACUCCUCCAGGUCUUGGAGUAGGUCAUUGGGUGGAUCCUCUAUUUCCUUACGUGGGCCACUGGAUGGCUCCUCCAUGUCUUGGAGUAGAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications