v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) EVX1 antisense RNA (EVX1-AS) URS00006213E8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

EVX1-AS: EVX1-AS is a long non-coding RNA (lncRNA) that has been found to be closely associated with the prognosis of colon cancer [PMC9200062]. It has also been predicted to be potentially associated with the development of multiple cancers [PMC9200062]. EVX1-AS, along with ZNF667-AS1, has been predicted to be related to colon cancer in LncRNADisease V2.0 [PMC8035745]. A significant six-lncRNA risk prognosis model, including EVX1-AS, has been presented to estimate the overall survival of colon cancer patients [PMC8035745]. In a study on breast cancer, EVX1-AS was among the 69 differentially methylated lncRNAs identified [PMC5701091]. High expression of EVX1-AS was associated with poorer prognosis in another study on breast cancer patients [PMC7607722]. In mouse embryos, EVX1-AS is co-expressed with Evx1 coding transcripts in the primitive streak [PMC7652816]. Reduction in EVX1-AS RNA levels phenocopies loss-of-function of Evx1 [PMC7652816]. EVX1-AS has also been reported to promote the transcription of the EVX1 gene during mesodermal differentiation by modifying chromatin accessibility [PMC7242645]. In bladder cancer, EVX1-AS is part of a gene regulatory network involving multiple mRNAs and lncRNAs [PMC6745163]. The Meteor enhancer and its lncRNA may act similarly to EVX1-AS during pluripotency by priming a permissive chromatin state [PMC5703900].

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGCCCAGGGAAAAAAGGCUUGGCCUCAUAGAAGCGGCAAAGGGCUCCUGGGGCAUCUGCAGCCUCCCUGGCCAACAAAAAAGUGGGGGCAGGGAGAGAUGGAGCCGCAAGUUGAGAAGUGUCACAAAGCUGGGAAUGAGGAAAGAGAUCAGGUGCUGGCAGACGCCAGACCCAGAAGAUGCUGUGUAGUCGAGGCUCCAGGUCCCAUGCCAAGGGGCUGGAUUCUCCCUGGUAGUAAAUCAUCUCUCACUCUCUCCUCCAAAUGACUGAUGGCCUUAAGUUUUCCACAGCCUGGCUUCAUCUUGAGAUGGCUAUUCGUACAAGAAGUCGCUUUCCCGUUUGCCUGGACCUCGCCUGCACUCCAGUCCCUGCCUAGGGGCAGUGGUACCUGUCUCCAAAAGUGGAUGGCGUUUGAGGUAGAAGAGAGUGAAGUCGCUGAAAAUGCCCUAAAACAGCAAGGAAGAAGCUGGUAUAAAACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications