v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Val (anticodon AAC) 1-1 (TRV-AAC1 1 to 5) secondary structure diagram

Homo sapiens (human) tRNA-Val (anticodon AAC) 1-1 (TRV-AAC1 1 to 5) URS000061D582_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCGGAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 88 other species

  1. Ailuropoda melanoleuca tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  2. Alligator mississippiensis tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  3. Amazona aestiva (blue-fronted amazon) tRNA-Val
  4. Ameiurus melas tRNA-Val
  5. Anguilla anguilla tRNA-Val
  6. Anolis carolinensis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  7. Apaloderma vittatum tRNA
  8. Balaenoptera acutorostrata scammoni tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  9. Bos taurus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  10. Callithrix jacchus tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  11. Callorhinchus milii tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  12. Canis lupus familiaris tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  13. Carlito syrichta tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  14. Cavia porcellus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  15. Ceratotherium simum simum tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  16. Chelydra serpentina tRNA-Val
  17. Chlorocebus sabaeus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  18. Choloepus hoffmanni tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  19. Chrysemys picta bellii tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  20. Columba livia partial tRNA-Val
  21. Cricetulus griseus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  22. Danionella translucida tRNA-Val
  23. Danio rerio tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  24. Dasypus novemcinctus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  25. Dipodomys ordii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  26. Echinops telfairi tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  27. Eptesicus nilssonii tRNA-Val
  28. Equus caballus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  29. Erinaceus europaeus tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  30. Felis catus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  31. Gallus gallus tRNA-Val (AAC) (tRNA-Val-AAC-2-1)
  32. Geospiza fortis tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  33. Gorilla gorilla gorilla tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  34. Heterocephalus glaber tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  35. Ictidomys tridecemlineatus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  36. Lamprotornis superbus tRNA-OTHER
  37. Larimichthys crocea tRNA
  38. Latimeria chalumnae tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  39. Loxodonta africana tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  40. Macaca mulatta tRNA-Val (AAC) (tRNA-Val-AAC-4-1, tRNA-Val-AAC-4-2, tRNA-Val-AAC-4-4)
  41. Marmota monax (woodchuck) tRNA.Val
  42. Meleagris gallopavo tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  43. Melopsittacus undulatus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  44. Microcebus murinus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  45. Monodelphis domestica tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  46. Mus caroli tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  47. Mus musculus castaneus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  48. Mus musculus domesticus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  49. Mus musculus musculus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  50. Mus musculus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  51. Mus pahari tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  52. Mus spretus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  53. Mustela putorius furo tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  54. Myotis lucifugus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  55. Nomascus leucogenys tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 5)
  56. Notamacropus eugenii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  57. Nothobranchius furzeri tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  58. Ochotona princeps tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  59. Oreochromis niloticus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  60. Ornithorhynchus anatinus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  61. Oryctolagus cuniculus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  62. Oryzias latipes tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  63. Otolemur garnettii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  64. Ovis aries tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  65. Pangasianodon gigas tRNA-Val
  66. Pangasianodon hypophthalmus tRNA-Val
  67. Pangasius djambal tRNA-Val
  68. Pan troglodytes tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 7)
  69. Papio anubis tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 5)
  70. Pelobates cultripes (western spadefoot toad) tRNA.Val
  71. Perca fluviatilis (European perch) tRNA-Val
  72. Petromyzon marinus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
  73. Phrynosoma platyrhinos tRNA-OTHER
  74. Podarcis lilfordi tRNA.Val
  75. Pongo abelii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3, tRNA-Val-AAC-1-5, tRNA-Val-AAC-1-6)
  76. Procavia capensis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  77. Rattus norvegicus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  78. Saimiri boliviensis boliviensis tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 3)
  79. Sarcophilus harrisii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  80. Scleropages formosus (Asian bonytongue) tRNA-Val
  81. Sorex araneus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  82. Sphaerodactylus townsendi tRNA-Val
  83. Sus scrofa tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  84. Taeniopygia guttata tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  85. Takifugu rubripes tRNA-Val (AAC) (tRNA-Val-AAC-2-1)
  86. Trichechus manatus latirostris tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  87. Tursiops truncatus tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  88. Vicugna pacos tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  89. Xenopus tropicalis tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
 2D structure Publications