Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-146b-5p URS000061B694_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (PSICQUIC, MalaCards, GeneCards, LncBase, ENA, TarBase). Described in 20 papers. Homo sapiens (human) hsa-miR-146b-5p sequence is a product of hsa-miR-146b, HSA-MIR-RG-47 variant 2, MIR-RG-47 variant 2, hsa-miR-146b-5p, miR-146b-5p, MIR146B, miR-146, miR-146b genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 182-FIP, 82-FIP, A170, A2D, A2lp, A8-51, AAAT, AAK1, AATYK2, ABC35.

Interactions 10

According to PSICQUIC, Homo sapiens (human) hsa-miR-146b-5p interacts with:

Interaction id Participant Synonyms
URS000061B694_9606-0 P05231 P05231
URS000061B694_9606-5 P05231 P05231
URS000061B694_9606-1 P51617 P51617
URS000061B694_9606-6 P51617 P51617
URS000061B694_9606-2 Q16552 Q16552
URS000061B694_9606-7 Q16552 Q16552
URS000061B694_9606-8 Q9H4E5 Q9H4E5
URS000061B694_9606-3 Q9H4E5 Q9H4E5
URS000061B694_9606-4 Q9Y4K3 Q9Y4K3
URS000061B694_9606-9 Q9Y4K3 Q9Y4K3

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGAACUGAAUUCCAUAGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Alligator mississippiensis ami-miR-146b-5p
    2. Canis lupus familiaris (dog) cfa-miR-146b
    3. Equus caballus eca-miR-146b-5p
    4. Macaca mulatta mml-miR-146b-5p
    5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146b-5p
    6. Mus musculus mmu-miR-146b-5p
    7. Ornithorhynchus anatinus oan-miR-146b-5p
    8. Pan troglodytes (chimpanzee) ptr-miR-146b
    9. Petromyzon marinus (sea lamprey) pma-miR-146-5p
    10. Pongo pygmaeus ppy-miR-146b-5p
    11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63160