Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-146b-5p URS000061B694_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (LncBase, RefSeq, ENA, TarBase, miRBase, PirBase, IntAct). Mus musculus (house mouse) mmu-miR-146b-5p sequence is a product of miR-146b-5p, mmu-miR-146b, mmu-miR-146b-5p, miR-146b, miR-146, Mir146b genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1110001M19Rik, 1110001P04Rik, 1110003E12Rik, 1110020D10Rik, 1110029L17Rik, 1110030L07Rik, 1110030M22Rik, 1110033A15Rik, 1110054N12Rik, 1110055B05Rik.

Interactions 3

According to IntAct, Mus musculus (house mouse) mmu-miR-146b-5p interacts with:

Interaction id Participant Synonyms
EBI-25612354 intact:EBI-25470703 EBI-25470703 ENSMUST00000159699 mra_hmga2 mouse
EBI-25616282 intact:EBI-25616305 EBI-25616305 ENSMUST00000025393 mrna_smad4-1
EBI-25616292 intact:EBI-25616322 EBI-25616322 ENSMUST00000028288 mrna_notch1-1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGAACUGAAUUCCAUAGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Alligator mississippiensis (American alligator) ami-miR-146b-5p
    2. Canis lupus familiaris (dog) cfa-miR-146b
    3. Equus caballus eca-miR-146b-5p
    4. Homo sapiens hsa-miR-146b-5p
    5. Macaca mulatta mml-miR-146b-5p
    6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146b-5p
    7. Ornithorhynchus anatinus (platypus) oan-miR-146b-5p
    8. Pan troglodytes ptr-miR-146b
    9. Petromyzon marinus (sea lamprey) pma-miR-146-5p
    10. Pongo pygmaeus ppy-miR-146b-5p
    11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63160
    Publications New