Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nuclear RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nuclear RNA URS00006184A9_559292

Automated summary: This snRNA sequence is 112 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (RefSeq, PDBe, ENA, IntAct, SGD). Described in 225 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (U6, RF00026). Saccharomyces cerevisiae S288C Small Nuclear RNA sequence is a product of SNR6 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 35

According to IntAct, Saccharomyces cerevisiae S288C Small Nuclear RNA interacts with:

Interaction id Participant Synonyms
EBI-11789541 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-14060329 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-12499015 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-11658228 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-11658276 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-11683539 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-11689870 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-11762746 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-11789513 URS00001143F5_559292 EBI-10054797 URS00001143F5_559292 snr14_u4_yeast
EBI-11791409 P20053 D6W4H8 EBI-219 P20053 P9705.6 PRP4 Pre-mRNA-processing protein 4 RNA4 YPR178W prp4_yeast
EBI-11791451 P20053 D6W4H8 EBI-219 P20053 P9705.6 PRP4 Pre-mRNA-processing protein 4 RNA4 YPR178W prp4_yeast
EBI-14060280 P32639 BRR2 D3DM80 EBI-861 P32639 Protein Snu246 RSS1 SNU246 SYGP-ORF66 YER172C brr2_yeast
EBI-11705262 P32639 BRR2 D3DM80 EBI-861 P32639 Protein Snu246 RSS1 SNU246 SYGP-ORF66 YER172C brr2_yeast
EBI-11708258 P32639 BRR2 D3DM80 EBI-861 P32639 Protein Snu246 RSS1 SNU246 SYGP-ORF66 YER172C brr2_yeast
EBI-10958289 P38203 D6VPX4 EBI-180 LSM2 P38203 SMX5 SNP3 Small nuclear ribonucleoprotein D homolog SNP3 YBL026W YBL0425 lsm2_yeast
EBI-11794909 P39990 D3DLM2 EBI-12032 P39990 SNU13 Small nuclear ribonucleoprotein-associated protein 1 YEL026W snu13_yeast
EBI-10958305 P40070 D3DM18 EBI-188 LSM4 P40070 Q07091 SDB23 USS1 YER112W lsm4_yeast
EBI-10958324 P40089 D3DM53 EBI-10236 LSM5 P40089 YER146W lsm5_yeast
EBI-10958600 P40204 D6VTL2 EBI-637 P40204 SMX2 SNP2 Sm protein G YFL017Bw YFL017W-A ruxg_yeast
EBI-10958404 P47093 D6VWJ6 EBI-313 J1464 LSM8 P47093 YJR022W YJR83.16 lsm8_yeast
EBI-10958681 P47093 D6VWJ6 EBI-313 J1464 LSM8 P47093 YJR022W YJR83.16 lsm8_yeast
EBI-14060343 P49704 D6VUM3 EBI-347 P49704 PRP31 Q66R99 YGR091W prp31_yeast
EBI-11791436 P49704 D6VUM3 EBI-347 P49704 PRP31 Q66R99 YGR091W prp31_yeast
EBI-11791708 P49704 D6VUM3 EBI-347 P49704 PRP31 Q66R99 YGR091W prp31_yeast
EBI-12499072 P49704 D6VUM3 EBI-347 P49704 PRP31 Q66R99 YGR091W prp31_yeast
EBI-12560791 P49960 D6W094 E9P966 EBI-212 P49960 PRP24 YM8156.10C YMR268C prp24_yeast
EBI-10829460 P53131 D6VU28 EBI-505 Helicase JA1 P53131 PRP43 YGL120C prp43_yeast
EBI-10958584 P54999 D6W4I2 EBI-770 P54999 P9705.4 SMX3 Sm protein F YPR182W ruxf_yeast
EBI-10958159 P57743 D6VZ73 EBI-10227 LSM3 P57743 Q05176 Q06759 SMX4 SmX4 protein USS2 YLR438C-A lsm3_yeast
EBI-10958504 Q02260 D6VUK6 EBI-585 Q02260 SMD1 YGR074W smd1_yeast snRNP core protein D1
EBI-13949516 Q03338 D6VT97 D8035.16 EBI-421 PRP3 Pre-mRNA-splicing factor 3 Q03338 RNA3 YDR473C prp3_yeast
EBI-14060289 Q03338 D6VT97 D8035.16 EBI-421 PRP3 Pre-mRNA-splicing factor 3 Q03338 RNA3 YDR473C prp3_yeast
EBI-10958664 Q06406 D6VT10 D9481.18 EBI-196 LSM6 Q06406 YDR378C lsm6_yeast
EBI-10958336 Q06406 D6VT10 D9481.18 EBI-196 LSM6 Q06406 YDR378C lsm6_yeast
EBI-11621256 Q08162 Chromosome disjunction protein 3 D6W244 DIS3 EBI-1740 O2197 Q08162 RRP44 Ribosomal RNA-processing protein 44 YOL021C rrp44_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUUCGCGAAGUAACCCUUCGUGGACAUUUGGUCAAUUUGAAACAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUAUUUCGUUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 91 other species

    1. Saccharomyces cerevisiae EC1118 SNR6
    2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR6
    3. Saccharomyces cerevisiae P283 SNR6
    4. Saccharomyces cerevisiae P301 SNR6
    5. Saccharomyces cerevisiae R008 SNR6
    6. Saccharomyces cerevisiae R103 SNR6
    7. Saccharomyces cerevisiae YJM1078 SNR6
    8. Saccharomyces cerevisiae YJM1083 SNR6
    9. Saccharomyces cerevisiae YJM1129 SNR6
    10. Saccharomyces cerevisiae YJM1133 SNR6
    11. Saccharomyces cerevisiae YJM1190 SNR6
    12. Saccharomyces cerevisiae YJM1199 SNR6
    13. Saccharomyces cerevisiae YJM1202 SNR6
    14. Saccharomyces cerevisiae YJM1208 SNR6
    15. Saccharomyces cerevisiae YJM1242 SNR6
    16. Saccharomyces cerevisiae YJM1244 SNR6
    17. Saccharomyces cerevisiae YJM1250 SNR6
    18. Saccharomyces cerevisiae YJM1252 SNR6
    19. Saccharomyces cerevisiae YJM1273 SNR6
    20. Saccharomyces cerevisiae YJM1304 SNR6
    21. Saccharomyces cerevisiae YJM1307 SNR6
    22. Saccharomyces cerevisiae YJM1311 SNR6
    23. Saccharomyces cerevisiae YJM1326 SNR6
    24. Saccharomyces cerevisiae YJM1332 SNR6
    25. Saccharomyces cerevisiae YJM1336 SNR6
    26. Saccharomyces cerevisiae YJM1338 SNR6
    27. Saccharomyces cerevisiae YJM1342 SNR6
    28. Saccharomyces cerevisiae YJM1355 SNR6
    29. Saccharomyces cerevisiae YJM1356 SNR6
    30. Saccharomyces cerevisiae YJM1383 SNR6
    31. Saccharomyces cerevisiae YJM1385 SNR6
    32. Saccharomyces cerevisiae YJM1386 SNR6
    33. Saccharomyces cerevisiae YJM1387 SNR6
    34. Saccharomyces cerevisiae YJM1388 SNR6
    35. Saccharomyces cerevisiae YJM1389 SNR6
    36. Saccharomyces cerevisiae YJM1399 SNR6
    37. Saccharomyces cerevisiae YJM1400 SNR6
    38. Saccharomyces cerevisiae YJM1401 SNR6
    39. Saccharomyces cerevisiae YJM1402 SNR6
    40. Saccharomyces cerevisiae YJM1415 SNR6
    41. Saccharomyces cerevisiae YJM1417 SNR6
    42. Saccharomyces cerevisiae YJM1418 SNR6
    43. Saccharomyces cerevisiae YJM1419 SNR6
    44. Saccharomyces cerevisiae YJM1433 SNR6
    45. Saccharomyces cerevisiae YJM1434 SNR6
    46. Saccharomyces cerevisiae YJM1443 SNR6
    47. Saccharomyces cerevisiae YJM1444 SNR6
    48. Saccharomyces cerevisiae YJM1450 SNR6
    49. Saccharomyces cerevisiae YJM1460 SNR6
    50. Saccharomyces cerevisiae YJM1463 SNR6
    51. Saccharomyces cerevisiae YJM1477 SNR6
    52. Saccharomyces cerevisiae YJM1478 SNR6
    53. Saccharomyces cerevisiae YJM1479 SNR6
    54. Saccharomyces cerevisiae YJM1526 SNR6
    55. Saccharomyces cerevisiae YJM1527 SNR6
    56. Saccharomyces cerevisiae YJM1573 SNR6
    57. Saccharomyces cerevisiae YJM1574 SNR6
    58. Saccharomyces cerevisiae YJM1592 SNR6
    59. Saccharomyces cerevisiae YJM1615 SNR6
    60. Saccharomyces cerevisiae YJM189 SNR6
    61. Saccharomyces cerevisiae YJM193 SNR6
    62. Saccharomyces cerevisiae YJM248 SNR6
    63. Saccharomyces cerevisiae YJM270 SNR6
    64. Saccharomyces cerevisiae YJM271 SNR6
    65. Saccharomyces cerevisiae YJM320 SNR6
    66. Saccharomyces cerevisiae YJM326 SNR6
    67. Saccharomyces cerevisiae YJM428 SNR6
    68. Saccharomyces cerevisiae YJM450 SNR6
    69. Saccharomyces cerevisiae YJM451 SNR6
    70. Saccharomyces cerevisiae YJM453 SNR6
    71. Saccharomyces cerevisiae YJM456 SNR6
    72. Saccharomyces cerevisiae YJM470 SNR6
    73. Saccharomyces cerevisiae YJM541 SNR6
    74. Saccharomyces cerevisiae YJM554 SNR6
    75. Saccharomyces cerevisiae YJM555 SNR6
    76. Saccharomyces cerevisiae YJM681 SNR6
    77. Saccharomyces cerevisiae YJM682 SNR6
    78. Saccharomyces cerevisiae YJM683 SNR6
    79. Saccharomyces cerevisiae YJM689 SNR6
    80. Saccharomyces cerevisiae YJM693 SNR6
    81. Saccharomyces cerevisiae YJM969 SNR6
    82. Saccharomyces cerevisiae YJM972 SNR6
    83. Saccharomyces cerevisiae YJM975 SNR6
    84. Saccharomyces cerevisiae YJM978 SNR6
    85. Saccharomyces cerevisiae YJM981 SNR6
    86. Saccharomyces cerevisiae YJM984 SNR6
    87. Saccharomyces cerevisiae YJM987 SNR6
    88. Saccharomyces cerevisiae YJM990 SNR6
    89. Saccharomyces cerevisiae YJM993 SNR6
    90. Saccharomyces cerevisiae YJM996 SNR6
    91. Saccharomyces cerevisiae U6 snRNA from Saccharomyces cerevisiae (PDB 5LQW, chain 6)
    2D structure New