Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Helicobacter pylori responsive 1 (HPYR1) URS0000615ADA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HPYR1: HPYR1 (Helicobacter pylori Responsive Transcript 1) is a previously uncharacterized long intergenic non-coding RNA (lincRNA) that is heavily upregulated in gastric mucosal cells infected with H. pylori [PMC5753088]. Among a total of 41 lncRNAs that showed alterations in ≥10% of cases, HPYR1 was one of the 15 lncRNAs that accounted for a total of 30% [PMC5647044]. HPYR1 was also found to be differentially expressed in different subtypes of breast cancer, including luminal A, luminal B, HER2-positive, and basal-like subtypes [PMC8758778]. In addition, HPYR1 was identified as one of the survival-related DElncRNAs in DElncRNA-mediated ceRNA networks [PMC9372196]. HPYR1 has also been detected in retinoblastoma and Alzheimer's disease [PMC9454787] [PMC9126031]. The expression of HPYR1 has been correlated with tumor metastasis and patient overall survival in certain cancers [PMC6580006]. Furthermore, HPYR1 has been found to have notable expression at the single-cell level in cutaneous melanoma [PMC7868446]. References: - PMC5753088 - PMC5647044 - PMC8758778 - PMC9372196 - PMC9454787 - PMC9126031 - PMC6580006 - PMC7868446

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUUCUGGGAGCCGCAGAGAGAAAGGUAGGAUCUUGUUUUGCUGCAGGCUGACCUUGUGAGGUUUAGGUUUAGGUGGGGCCAUCUGGAAGAGUAAGCUCUACCCCUUAGAACAGGGCAGGAGGAGGGGAGGACUCUUCCAUUCUGAGAUACAAAUAAAACCCACCUUAUACCAUGAACAUUAUUUUCCAAAAAACCCUGAUUUGGACUCCAUAUGGCAGUCAUAUAUAUUCUUUCUGGUAACAUAACUUUGCUUGGCCUCAUUUCUUGUGAACAGUCGUGGUCUUAUUUUGUUUAGAGAUUGUUCAUGCAAUAGCUGCCUUGGGUAACCAACAGAGCUGUAGGACGUUGUCAGACAAUGACGCAUUCUGUGCCCAAUCUCUUCUCCUGAAUUCCCAGGAUUCACCUCCAAGUUAGGAAGGCAGUGGUAUUUUUAUUUAAGUAGCUACCCUAUGCAAAGCCAUAUCUCUCCUUAGGACUCAGCCAGUUUCCCCAGGUUCUGCUAAAGGCGUAUUUUGGAAUUGUCACCACACUAUCCUCUGAGCCACCACUCUUCUCGGGAGGUUAAAGUCUGUUCCUGGUACAGCUCUUGAAGCCAACCCCUGCACUCAUCAGGUUGAGUUCUCCCCCAAAAAUGAGUUAACAGAGCAGGUCUGAGGCUGCUAUGCUUAGAAAGACCUGCAGGCAUGGCCGUCAUCUGGGAACUUGGACUUGGGGAGGGUUUCCACCUUCCCCAGAAUUGAUAAGCGUGGCUCACAGUACCUAAACAGACGAUGUGGUAUAUGUUGAACUUCUGCUUUCCCUUCUGGGAGUCUGGAAUUUUGGUAUGUGCCAGGUAGAGGCAGACAAUAAAAGCCUUGGGCCCUGAGUCUCUAAGAAGUAUUCCUGGUAGACAGCAUUUAACACAUGGCAUGACUUGUUGCUGGAAGAAUUGAAUAUAUGCCAUGUGACCCCAUGGGGAAAAGACUCUUGGGAGCUUUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications